Skip to main content

Table 2 Sequences of polymerase chain reaction primers used for the detection of miRNA expression

From: A novel method to establish the rabbit model of knee osteoarthritis: intra-articular injection of SDF-1 induces OA

Name Sequence Length
GAPDH-F TTAACTCTGGCAAAGTGGAT 89
GAPDH-R GGTGGAATCATACTGGAACA
MMP3-F CCAGACATATAGCAGAAGAC 106
MMP3-R AACTCCGACTGTGAAGAT
MMP9-F TCTGCAACGTGAATGTCT 75
MMP9-R AGTACCTCCCATCCTTGA
MMP13-F AACAGTAACGAGGATGAT 81
MMP13-R CAGAGGATGGTAGTATGAT
Collagen II-F AGAGGTATAATGATAAGGAT 100
Collagen II-R GTGTCTTCACAGATTATG
Aggrecan-F GTAGTGGTGAATCTTCTG 86
Aggrecan-R TAAGCCTTCTTCTTCTCT