Skip to main content

Table 1 Primers used in the present study

From: Identification of lncRNAs associated with the pathogenesis of ankylosing spondylitis

Gene Primers sequences pcr product length (bp)
GAPDH F: ACAACTTTGGTATCGTGGAAGG 101
R: GCCATCACGCCACAGTTTC  
NONHSAT118801.2 F: AGTCCCTGCTTTTAATTCTTTGGGG 155
R: CAAGGAGGCAAACTCGGCTGC  
NONHSAT183847.1 F: GACACGGCTGCGTCCCTGAA 133
R: GTGTGTGGTGGGCAGGGGAG  
ENST00000444046 F: CGACGGATCGGGAAAGCCAA 106
R: GCCCGTTGTGAGCCTGAGAG  
NONHSAT205110.1 F: GGAGGCATGGGCTTGTCAAA 196
R: CAAGCTTGTATTGCAGAAACTGT  
NONHSAT105444.2 F:CCACTCCGGGACATCTGCAC 81
R: CCAGGCAGGTGGGTGTCAAC  
NONHSAT051856.2 F: GGGTCCTGCTTGTTGCCTGT 153
R: GCTGTGGCTGTCCCAAACCT