Skip to main content

Table 1 Primer sequences

From: Elevated levels of TNF-α, IL-1β and IL-6 in the synovial tissue of patients with labral tear: a comparative study with hip osteoarthritis

Gene Direction Primer sequence (5′–3′) Product size (bp)
TNFA Sense CTTCTGCCTGCTGCACTTTG 118
Antisense GTCACTCGGGGTTCGAGAAG
IL1B Sense GTACCTGTCCTGCGTGTTGA 153
Antisense GGGAACTGGGCAGACTCAAA
IL6 Sense GAGGAGACTTGCCTGGTGAA 199
Antisense TGGCATTTGTGGTTGGGTCA
COX2 Sense TGGCTGAGGGAACACAACAG 74
Antisense AACAACTGCTCATCACCCCA
GAPDH Sense TGTTGCCATCAATGACCCCTT 202
Antisense CTCCACGACGTACTCAGCG