Skip to main content

Table 5 Information of mouse primers for Real-time PCR

From: The hsa-miR-181a-5p reduces oxidation resistance by controlling SECISBP2 in osteoarthritis

Gene Sequence (5′-3′) Product size (bp) Annealing temperature (°Χ)
Sbp2 Forward:CTGCTCCAAAGGCCAAAG 195 60
Reverse:GTGATTGCCCTCTGTGTCTTC
β-Actin Forward:AACAGTCCGCCTAGAAGCAC 281 60
Reverse:CGTTGACATCCGTAAAGACC