Skip to main content

Table 2 Information of Stem-loop hsa-miR-181a

From: The hsa-miR-181a-5p reduces oxidation resistance by controlling SECISBP2 in osteoarthritis

ID Accession Location Stem-loop sequence (5′-3′)
hsa-mir-181a-1 (hsa-mir-213) MI0000289 1q32.1 UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUCAAAACCAUCGACCGUUGAUUGUACCCUAUGGCUAACCAUCAUCUACUCCA
hsa-mir-181a-2 MI0000269 9q33.3 AGAAGGGCUAUCAGGCCAGCCUUCAGAGGACUCCAAGGAACAUUCAACGCUGUCGGUGAGUUUGGGAUUUGAAAAAACCACUGACCGUUGACUGUACCUUGGGGUCCUUA