Skip to main content

Table 1 Primers of genes

From: Effects of Osteoglycin (OGN) on treating senile osteoporosis by regulating MSCs

Gene (mouse)   DNA sequence (forward/reverse, 5′-3′)
PPARγ2 Forward ATGGGTGAAACTCTGGGAGA
Reverse GAGCTGATTCCGAAGTTGGT
OGN Forward GGCGCTACCTGTATCAATGG
Reverse TCAGCCAACTCGTCACAGTC
ALP Forward GTGCAGTCTGTGTCTTGCCTG
Reverse CCTTGCCTGTATCTGGAATCCT
RUNX2 Forward CACCGAGACCAACCGAGTCA
Reverse TGCTCGGATCCCAAAAGAAG
Col1a1 Forward CAACCTGGACGCCATCAAG
Reverse ATCGGTCATGCTCTCTCCAAA
OCN Forward AGCTTAACCCTGCTTGTGACG
Reverse GGAGGATCAAGTCCCGGAGA
Rankl Forward CACCATCAGCTGAAGATAGT
Reverse CCAAGATCTCTAACATGACG
aP2 Forward CACCGCAGACGACAGGAAG
Reverse GCACCTGCACCAGGGC
Wnt5b Forward CTGCTGTTTTGAGGGGATTC
Reverse CGCACTGAGCAATTAAGCAG
β-actin Forward GTTGTCGACGACGAGCG
Reverse GCACAGAGCCTCGCCTT
\