Skip to main content

Table 2 Primers used for qPCR (SYBR Green)

From: The tenocyte phenotype of human primary tendon cells in vitro is reduced by glucocorticoids

Gene Sequence
Gapdh Glyceraldehyde 3-phosphate dehydrogenase F: TGACGCTGGGGCTGGCATTG
R: GGCTGGTGGTCCAGGGGTCT
Col1 Collagen type 1 F: CGATGGATTCCAGTTCGAGTAT
R: CATCGACAGTGACGCTGTAGG
Col14 Collagen type 14 F: AAGGATTGCCCTCCGACTACAC
R: CTGATGCGTTCATTGCCTTCTC
Cebpa CCAAT/enhancer-binding protein alpha F: GCGGCGACTTTGACTACC
R: GCTTGGCTTCATCCTCCTC
Ocn Osteocalcin F: GACACCATGAGGACCCTCTC
R: GCCTGGTAGTTGTTGTGAGC
Scx Scleraxis F: CGAGAACACCCAGCCCAAAC
R: CTCCGAATCGCAGTCTTTCTGTC
Sox9 SRY-box 9 F: GGCGGAGGAAGTCGGTGAAGAA
R: GCTCATGCCGGAGGAGGAGTGT
Tnmd Tenomodulin F: TGGGTGGTCCCTCAAGTGAAAGT
R: CTCGACGGCAGTAAATACAACAATA