Skip to main content

Table 1 Primers of target genes

From: Surgical removal and controlled trypsinization of the outer annulus fibrosus improves the bioactivity of the nucleus pulposus in a disc bioreactor culture

Gene Accession number Forward (5′-3′) Reverse (5′-3′)
GAPDH NM_001082253.1 GACCACTTTGTGAAGCTCATTTC GTGGTTTGAGGGCTCTTACTC
Aggrecan XM_002723376.1 CTCCCTGGTAGATACTCCATTG CTGGAGGGAAGTCCAGATATT
Collagen II NM_001195671.1 AGCGGTGACTACTGGATAGA CTGCTCCACCAGTTCTTCTT
Collagen I XM_002719108.1 GGTACAGTGAAGGCGAAATATG ACAGTCCTTGGTGTCTTCA
ADAMTs-4 XM_002715171.1 AGCGCCCACTTCATCACCAAC GGGCGAGTGCTTGGTCTGG
MMP-3 NM_001082280.1 GTTCCTGATGTTGGTCACTTC GCAGATCCGGTGTGTAATTC
TIMP-1 NM_001082232.2 TACTCCCACAAATCCCAGAA AACCACGAAACTGCAAGTC
TIMP-3 NM_001195682.1 CGTGTTTATGATGGCAAGGT AGGTGGTAGCGATAGTTCAG