Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primer pairs and oligonucleotide probes used in this study.

From: Delayed union of femoral fractures in older rats:decreased gene expression

Gene Amplimer Annealing T Sense Antisense Probe Accession
  Size (bp) Temp. (C)     
Osteocalcin 411 60 TCTCTCTGCTCACTCTGCTG ATTTTGGAGCAGCTGTGCCG AGGTGGTGAATAGACTCCGG M23637
Type I Collagen 410 62 AGGGACACAGAGGTTTCAGTG ACCATTGGCACCTTTAGCACC ATCGTTACCACGAGCACCAG Z78279
Type II Collagen 563 62 TCATAGGACCTAAAGGACCTCC TTCTCCCTTAGCACCATCGAG AACTTTGCAGCCCAGATGGCT L48440
BMP-2 570 60 ACGTCCTCAGCGAGTTTGAG CACCTGGCTTCTCCTCTAAG CTTCCCGACGCTTCTTCTTC Z25868
BMP-4 601 60 ACTTCTGCAGATGTTTGGGCT AGGTAACGATCGGCTAATCCT CTATTTCGGGAGCAGGTGGA Z22607
BMP-receptor 472 58 TTGTCGCCATGATCGTCTTC AGGAAGTCATAGAGAGACCC TAAAGGCCGGTATGGAGAAG D38082
18S rRNA 321 66 AGGCCCTGTAATTGGAATGAGTC TTATTCCTAGCTGCGGTATCCAG AGCTCGTAGTTGGATCTTGG K01593
  1. Abbreviations: Base pairs (bp); temperature (Temp.). Accession refers to the entry in the Gen Bank database from which the primer pairs and probe were derived.