Skip to main content

Table 1 RT-qPCR primers

From: Enhanced collagen type I synthesis by human tenocytes subjected to periodic in vitro mechanical stimulation

Target Forward Primer Reverse Primer
GAPDH TCTTTTGCGTCGCCAGCCGAG TGACCAGGCGCCCAATACGAC
Collagen type I TGTTCAGCTTTGTGGACCTCCG CGCAGGTGATTGGTGGGATGTCT
Collagen type III AATCAGGTAGACCCGGACGA TTCGTCCATCGAAGCCTCTG
TGFB GCAACAATTCCTGGCGATACC AAAGCCCTCAATTTCCCCTCC
Scleraxis A AGAACACCCAGCCCAAACA TCGCGGTCCTTGCTCAACTT