Skip to main content

Table 2 Primers’ description

From: Estrogen receptors genes polymorphisms and age at menarche in idiopathic scoliosis

Gene SNP Enzyme 5’- > 3’ Sequence 5’- > 3’ Annealing temp Amplicon length
ESR1 rs9340799 XbaI F CTGCCACCCTATCTGTATCTTTTCCTATTCTCC 71°C 1300 bp
    R TCTTTCTCTGCCACCCTGGCGTCGATTATCTGA
  rs2234693 PuvII F AGGCTGGGCTCAAACTACAG 60°C 759 bp
    R TCCTTGGCAGATTCCATAGC
ESR2 rs1256049 Rsal F TTCTGAGCCGAGGTCGTAGT 66°C 582 bp
    R TGAATCCTTGGACCCAACTC
  rs4986938 AluI F GTGTGTGGTGGGACACAGAG 65°C 646 bp
    R AGGCCATTGAGTGTGGAAAC