Skip to main content

Table 1 PCR primer sequences for COL9A1, COL9A2, COL9A3, COMP, and MATN3

From: Novel COL9A3 mutation in a family diagnosed with multiple epiphyseal dysplasia: a case report

Primer sequences
COL9A1 gene Tm (°C) Product size (bp)
Exon 8-10 F - CCGATGTGCTCCACTAACCT 56 824
  R - GGCCAAGTTTAGAGCCACAG
COL9A2 gene   
Exon 2 F - CAGCTTCCTGCACTGTCTGA 56 241
  R - GACGAGGGGCACTACATCTC
Exon 3-4 F - TGAGCCGTAGTGTGCTGTCT 56 278
  R - CTGGAGGTCAATTGGCAGAG
COL9A3 gene   
Exon 2 F - TTTGGGTCTCACCGAGGA 56 293
  R - GCCTGGTTTTCTCTCCATCA
Exon 3 F - CTTGAGGGACCCCTGATTTT 56 152
  R - TGTTCTGAGTTCCCCCTTTC
Exon 4 F - GCATTTTGCTTCATTGCTGA 56 222
  R - AATTAGGGCCGGACTCCTC
COMP gene   
Exon 8-9 F - TTGAGGCGGGGTTGGGTG 64 413
  R - ACCGTGCCGAGCCGTAGAT
Exon 10 F - AGGAGTGTGACCTTTGCCTTCT 64 334
  R - CTAGTCCAGCTTACCCCATCC
Exon 11-12 F - GAAGTCATTCTGGCCTGGTC 64 518
  R - AGCGTTTTGTCAAAGGCTACC
Exon 13 F - CGGGTAGCCTTTGACAAAACG 62 331
  R - GCCCGCCCACCGTAGAC
Exon 14-15 F - GGCGGGCCCTGACTTTAG 64 546
  R - ATAACCCCGCCCCTCTGT
Exon 16 F - GTTCTGGGTGCCAGGTTC 64 335
  R - AAGGGTTTTACGGAGGGTCAT
Exon 17 F - TGCTCCCAACTGTCTCTCCA 64 312
  R - ACCTGGGCCTGTGTGTCC
Exon 18-19 F - TCTGAGAGGGAAGGGTCTGG 64 443
  R - CCCTTCTCACTTCCCCCTCA
MATN3 gene
Exon 3 F - AAAGGAGCCCAGAGAGCAAT 59 290
  R - CAGTCCAAAACCTGGAGCAT