Skip to main content

Table 2 Primer sequences used for real-time PCR

From: Increased CCL19 and CCL21 levels promote fibroblast ossification in ankylosing spondylitis hip ligament tissue

  Sense primer (5′ to 3′) Anti-sense primer (5′ to 3′)
Human CCL19 CCAACTCTGAGTGGCACCAA TGAACACTACAGCAGGCACC
Human CCL21 TGGCCTCTTACTCACCCTCT GCCTCTTGATCCCCTTAGCC
Human CCR7 GCCTACGACGTCACCTACAG GGCAGAAGAGTCGCCTATGG
Beta-actin CCATCGTCCACCGCAAAT TGTCACCTTCACCGTTCC
ALP ATCTTTGGTCTGGCTCCCATG TTTCCCGTTCACCGTCCAC
Human OCN GGCAGCGAGGTAGTGAAGAG CTGGAGAGGAGCAGAACTGG
Human COL1 GAG AGC ATG ACC GAT GG GTG ACG CTG TAG GTG AA
IBSP CGCCAATGAATACGACAATG GATGCAAAGCCAGAATGGAT
Human VEGF-A GAGCCTTGCCTTGCTGCTCTA CACCAGGGTCTCGATTGGAT
Runx-2 GCAGCAACCCAGAAACACTT AACACATGACCCAGTGCAAA
Osterix AGAGGAGAGACTCGGGACAG GAGTTGTTGAGTCCCGCAGA
  1. CCL19: Chemokine (C-C motif) ligand 19; CCR7: Chemokine receptor 7; ALP: Alkaline phosphatase; OCN: Osteocalcin; COL1: Collagenase I; IBSP: Integrin-binding sialoprotein; VEGF-A: Vascular endothelial growth factor-A; Runx-2: Runt-related transcription factor-2.