Skip to main content

Advertisement

Table 1 Primer sequences used for real-time PCR analysis

From: Matrix forming characteristics of inner and outer human meniscus cells on 3D collagen scaffolds under normal and low oxygen tensions

Gene Primer Sequence Direction Reference
Aggrecan 5AGGGCGAGTGGAATGATGTT3 Forward 32
5GGTGGCTGTGCCCTTTTTAC3 Reverse
COL1A2 5TTGCCCAAAGTTGTCCTCTTCT3 Forward 32
5AGCTTCTGTGGAACCATGGAA3 Reverse
COL2A1 5CTGCAAAATAAAATCTCGGTGTTCT3 Forward 32
5GGGCATTTGACTCACACCAGT3 Reverse
COMP 5GCGAAACGTGGGTTGGAA3 Forward 36
5GCCGGTGCTGCAGGAA3 Reverse
HIF- 5GTAGTTGTGGAAGTTTATGCTAATATTGTGT3 Forward 34
5CTTGTTTACAGTCTGCTCAAAATATCTT3 Reverse
HIF- 5GGTGGCAGAACTTGAAGGGTTA3 Forward 35
5GGGCAACACACACAGGAAATC3 Reverse
Sox9 5CTTTGGTTTGTGTTCGTGTTTTG3 Forward 32
5AGAGAAAGAAAAAGGGAAAGGTAAGTTT3 Reverse
β-actin 5AAGCCACCCCACTTCTCTCTAA3 Forward 32
  5AATGCTATCACCTCCCCTGTGT3 Reverse  
  1. All primers were purchased from Invitrogen (Mississauga, Ontario, Canada). COL1A2, collagen type I α2 chain; COL2A1, collagen type II α1 chain; COMP, cartilage oligomeric matrix protein; HIF-1α, hypoxia-inducible factor 1α; HIF-2α, hypoxia-inducible factor 2α; Sox9, Sry-related HMG box 9.