Skip to main content

Advertisement

Table 1 RT-PCR primer sequences and product length

From: Collagen type I and decorin expression in tenocytes depend on the cell isolation method

Target gene Primer sequence Length
1. GAPDH [NM_ 002046] Sense: GAGTCCACTGGCGTCTCCAC 188 bp
Antisense: GGTGCTAAGCAGTTGGTGGT  
2. collagen Typ I, alpha 1 [NM_000088] Sense: GGCCCAGAAGAACTGGTACA 200 bp
Antisense: GGCTGTTCTTGCAGTGGTAG  
3. collagen Typ III, alpha 1 [NM_033150] Sense: CCAGGAGCTAACGGTCTCAG 103 bp
Antisense. CAGGGTTTCCATCTCTTCCA  
4. decorin [NM_001920] Sense: TGCTGTTGACAATGGCTCTC 192 bp
Antisense: GCCTTTTTGGTGTTGTGTCC  
5. fibronectin [NM_212475] Sense: ATGATGAGGTGCACGTGTGT 135 bp
Antisense: CTCTTCATGACGCTTGTGGA  
6. tenascin-C [NM_002160] Sense: TCAAGGCTGCTACGCCTTAT 230 bp
Antisense: GTTCTGGGCTGCCTCTACTG  
7. Scleraxis[17] Sense: CCTGAACATCTGGGAAATTTTAC 111 bp
Antisense: CGCCAAGGCACCTCCTT  
8. tenomodulin [NM_022144] Sense: CCATGCTGGATGAGAGAGGT 123 bp
Antisense: CTCGTCCTCCTTGGTAGCAG  
9. osteopontin[26] Sense: TTGCTTTTGCCTCCTAGGCA 430 bp
Antisense: GTGAAAACTTCGGTTGCTGG  
10. aggrecan[27] Sense: CACTGTTACCGCCACTTCCC 183 bp
Antisense: ACCAGCGGAAGTCCCCTTCG