Skip to main content

Table 1 Primer Used in Real Time RT-PCR Analysis

From: Proteasome inhibition alleviates prolonged moderate compression-induced muscle pathology

Gene Accession Number Primers
   (F; forward primer, R; reverse primer)
Ubiquitin NM017314 F: 5'GGGCATGCAGATCTTTGTGAA3'
   R: 5'ACCTCCAGGGTGATGGTCTTG3'
MAFbx/atrogin-1 NM133521 F: 5'TGAAGACCGGCTACTGTGGAAGAGAC3'
   R: 5'TTGGGGTGAAAGTGAGACGGAGCAG3'
HIF-1α NM024359 F: 5'AACAAACAGAATCTGTCCTCAAACC3'
   R: 5'CAGGTAATGGAGACATTGCCAG3'
HSP70-1 X77207 F: 5'CGAGGGCATCGACTTCTACACG3'
   R: 5'ATCTGCGCCTTGTCCAGCTTG3'
HSP70-2 X77208 F: 5'CTCGTCCATGGTGCTGACCAAG3'
   R: 5'CCGCTGCGAGTCGTTGAAGTAG3'
HSP70-3 X77209 F: 5'AGGACTCAACGTGCTGCGAATC3'
   R: 5'TCAGGATGGACACGTCGAACG3'
β2M NM012512 F: 5'CGTGATCTTTCTGGTGCTTGTC3'
   R: 5'TTCTGAATGGCAAGCACGAC3'