Skip to main content

Table 1 Synthetic gene-specific primer sequences for collagen types I and III and for TGF-β1, -β2, -β3 and β-actin

From: Increased expression of collagens, transforming growth factor-β1, and -β3 in gluteal muscle contracture

Gene   Primers Product Size
Collagen types I Forward GTCGAGGGCCAAGACGAAG 143 bp
  Reverse CAGATCACGTCATCGCACAAC  
Collagen type III Forward TGGTCCCCAAGGTGTCAAAG 117 bp
  Reverse GGGGGTCCTGGGTTACCATTA  
TGF-β1 Forward GGCCAGATCCTGTCCAAGC 201 bp
  Reverse GTGGGTTTCCACCATTAGCAC  
TGF-β2 Forward TGCCATCCCGCCCACTTTC 252 bp
  Reverse GAGAGCCATTCGCCTTCTGC  
TGF-β3 Forward CTGTGCGTGAGTGGCTGTTG 406 bp
  Reverse GTGCTGTGGGTTGTGTCTGC  
β-actin Forward ATCGTGCGTGACATTAAGGAGAAG 179 bp
  Reverse AGGAAGGAAGGCTGGAAGAGTG