Skip to main content

Table 3 Sequence of primers used in qPCR in PBMC

From: Dysregulation of ribosome-related genes in ankylosing spondylitis: a systems biology approach and experimental method

Primer name Forward primer Reverse primer Product size (bp)
RPL23 TCCGGATTTCCTTGGGTCTTC CGTCCCTTGATCCCCTTCAC 103
RPL17 TGAAACTGCTCAGGCCATCAA GTGTCCAGCCCCATTGCTTG 149
RPL7 GCCCTTCAAATTGTCTTCTCCAC AATAAGCCTGTTGATCTGGTCCTC 106
rRNA18S pseudogene TGGTGGAGTGATTTGTCTGGT CATCTAAGGGCATCACAGACG 107
rRNA5-8S pseudogene GGCTCCTGCGTTGATGAAGA GCAAGTGCGTTCGAAGTGT 90
HPRT1 GGTGAAAAGGACCCCACGAA AGTCAAGGGCATATCCTACAACA 92
  1. PBMC Peripheral blood mononuclear cell, RPL Ribosomal protein, HPRT1 Hypoxanthine Phosphoribosyltransferase 1