Skip to main content

Table 1 Primer sequences used for polymerase chain reaction

From: In vitro and in vivo tenocyte-protective effectiveness of dehydroepiandrosterone against high glucose-induced oxidative stress

Gene Oligonucleotide sequence
NOX1 Forward 5’ GTGGCTTTGGTTCTCATGGT 3’ Reverse 5’ TGAGGACTCCTGCAACTCCT 3’
NOX4 Forward 5’ GGGCCTAGGATTGTGTTTGA 3’ Reverse 5’ CTGAGAAGTTCAGGGCGTTC 3’
Type I collagen Forward 5’ TGGAGACAGGTCAGACCTG 3’ Reverse 5’ TATTCGATGACTGTCTTGCC 3’
Type III collagen Forward 5’ TAAAGGGTGAACGGGGCAGT 3’ Reverse 5’ ACGTTCCCCATTATGGCCAC 3’
MMP-2 Forward 5’ GGAAGCATCAAATCGGACTG 3’ Reverse 5’ GGGCGGGAGAAAGTAGCA 3’
TIMP-1 Forward 5’ ATAGTGCTGGCTGTGGGGTGTG 3’ Reverse 5’ TGATCGCTCTGGTAGCCCTTCTC 3’
TIMP-2 Forward 5’ GGACACGCTTAGCATCACCCAGA 3’ Reverse 5’ GTCCATCCAGAGGCACTCATCC 3’
IL-6 Forward 5’ GGTCTTCTGGAGTTCCGTTTC 3’ Reverse 5’ GGTCTTGGTCCTTAGCCATCT 3’
GAPDH Forward 5’ GGTGGTCTCCTCTGACTTCAACA 3’ Reverse 5’ GTTGCTGTAGCCAAATTCGTTGT 3’