Skip to main content

Table 1 Primers used for quantitative RT-PCR experiments

From: Influence of Angptl1 on osteoclast formation and osteoblastic phenotype in mouse cells

Gene   Sequence
Angptl1 Forward CGACACAGTCCTAACAGCCACCAG
  Reverse TGACAGTCTTTGAATGGTCCTTC
TRAP Forward CAGCTGTCCTGGCTCAAAA
  Reverse ACATAGCCCACACCGTTCTC
Ctsk Forward GAGGGCCAACTCAAGAAGAA
  Reverse GCCGTGGCGTTATACATACA
NFATc1 Forward CAAGTCTCACCACAGGGCTCACTA
  Reverse GCGTGAGAGGTTCATTCTCCAAGT
MMP-9 Forward GGACCCGAAGCGGACATTG
  Reverse CGTCGTCGAAATGGGCATCT
DC-STAMP Forward CTAGCTGGCTGGACTTCATCC
  Reverse TCATGCTGTCTAGGAGACCTC
Runx2 Forward AAATGCCTCCGCTGTTATGAA
  Reverse GCTCCGGCCCACAAATCT
Osterix Forward AGCGACCACTTGAGCAAACAT
  Reverse GCGGCTGATTGGCTTCTTCT
ALP Forward ATCTTTGGTCTGGCTCCCATG
  Reverse TTTCCCGTTCACCGTCCAC
Osteocalcin Forward CCTGAGTCTGACAAAGCCTTCA
  Reverse GCCGGAGTCTGTTCACTACCTT
PPARγ Forward CCCAATGGTTGCTGATTACAAA
  Reverse AATAATAAGGTGGAGATGCAGGTTCT
aP2 Forward CTTCAAACTGGGCGTGGAA
  Reverse CCATCTAGGGTTATGATGCTCTTCA
GAPDH Forward ACGGCAAATTCAACGGCAC
  Reverse CTCCACGACATACTCAGCAC
β-actin Forward TACCACAGGCATTGTGATGG
  Reverse TTTGATGTCACGCACGATTT
  1. Angptl1, Angiopoietin like 1; TRAP, Tartrate-resistant acid phosphatase; Ctsk, cathepsin K; NFATc1, nuclear factor of activated T-cells, cytoplasmic 1; MMP-9, matrix metalloproteinase-9; DC-STAMP, dendrocyte expressed seven transmembrane protein; Runx2, Runt related transcription factor-2; ALP, alkaline phosphatase; PPARγ, peroxisome proliferator-activated receptor γ; aP2, adipocyte protein-2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase