Skip to main content

Table 1 Primers used in qRT-PCRa analysis to assess osteoclast and osteoblast function

From: Anti-IL17 antibody Secukinumab therapy is associated with ossification in giant cell tumor of bone: a case report of pathologic similarities and therapeutic potential similar to Denosumab

Gene Name Forward Primer Reverse Primer
HPRT TGAGGATTTGGAAAGGGTG GAGGGCTACAATGTGATGG
TRAP GACCACCTTGGCAATGTCTCTG TGGCTGAGGAAGTCATCTGAGTTG
Cathepsin K TGAGGCTTCTCTTGGTGTCCATAC AAAGGGTGTCATTACTGCGGG
RANKL GAGAAAGCGATGGTGGATGG CTTGCTCCTCTTGGCCAGAT
MMP9 TGGGGGGCAACTCGGC GGAATGATCTAAGCCCAG
OPG AGAAAGGAAATGCAACACACGAC CCTGAAGAATGCCTCCTCACAC
  1. a qRT-PCR reverse transcription-quantitative polymerase-chain-reaction