Skip to main content

Table 1 Primers used for amplification of target genes and GAPDH

From: Early patellofemoral articular cartilage degeneration in a rat model of patellar instability is associated with activation of the NF-κB signaling pathway

  Forward primer sequence Reverse primer sequence
Collagen X CCCTTTCTGCTGCTAGTGTCCT GGAATGCCTTGTTCTCCTCTTAC
MMP-13 TGCATACGAGCATCCATCCC CGTGTCCTCAAAGTGAACCGC
TNF-ɑ CCACCACGCTCTTCTGTCTACTG TGGGCTACGGGCTTGTCACT
NF-κB p65 CTTCACTCGGAGACTGGAACCT AAATCCTTCCCAAACTCCACC
GAPDH CTGGAGAAACCTGCCAAGTATG GGTGGAAGAATGGGAGTTGCT