Skip to main content

Table 1 The sequences of primers of RT-qPCR

From: Elevated lymphotoxin-α (TNFβ) is associated with intervertebral disc degeneration

Gene Name Forward/ Reverse 5′-3′Sequence Size
LTα Forward CCTGGCTGCACTCGATGT 127 bp
Reverse GCGAAGGCTCCAAAGAAG
Caspase-3 Forward CTGGACTGCGGTATTGAG 102 bp
Reverse GGGTGCGGTAGAGTAAGC
Caspase-1 Forward CAGGAGGGAATATGTGGG 120 bp
Reverse AACCTTGGGCTTGTCTTT
MMP-3 Forward ACCTATTCCTGGTTGCTG 105 bp
Reverse GGTCTGTGGAGGACTTGTA
Aggrecan Forward TGAAACCACCTCTGCATTCCA 96 bp
Reverse GACGCCTCGCCTTCTTGAA
Type II collagen Forward GTCACAGAAGACCTCACGCCTC 81 bp
Reverse TCCACACCGAATTCCTGCTC
GAPDH Forward TCAAGAAGGTGGTGAAGCAGG 115 bp
Reverse TCAAAGGTGGAGGAGTGGGT