Skip to main content

Table 1 Primer sequence

From: Carboxymethyl chitosan reduces inflammation and promotes osteogenesis in a rabbit knee replacement model

Gene Upstream Primer Downstream Primer
MMP9 GTACTCGACCTGTACCAGCG TTCAGGGCGAGGACCATAGA
OCN AGCAAAGGTGCAGCCTTTGT GCGCCTGGGTCTCTTCACT
OPG GGAACCCCAGAGCGAAATACA CCTGAAGAATGCCTCCTCACA
RANKL CAGAAGATGGCACTCACTGCA CACCATCGCTTTCTCTGCTCT
GAPDH ATGGGGAAGGTGAAGGTCG GGGGTCATTGATGGCAACAATA