Skip to main content

Table 1 Sequence of Primers Used for Polymerase Chain Reaction

From: Joint hemorrhage accelerates cartilage degeneration in a rat immobilized knee model

Gene Name GenBank Nucleic Acid Sequence
MMP-8 NM 022221 Upstream
Downstream
tggaatccttgcccatgcct
aagcagccacgagaaacaggt
MMP-13 NM 133530 Upstream
Downstream
tggtcttctggcacaacgctt
tggaagctgcttgtccaggtt
IL-1β NM 031512 Upstream
Downstream
accgtggcaacattctggtca
tcgacaaatgctgcctcgtga
TNF-α NM 0126763 Upstream
Downstream
actggcgtgttcaatccgttctctac
ccgcaaaatccaggccactacttc
EF1a1 NM 175838 Upstream
Downstream
tgatgccccaggacacaagagaact
gataccagcttcaaaattcccaacaac