Skip to main content

Table 2 P16, S100 primer sequence

From: The correlation between imaging expression of P16 and S100 in hypertrophic ligamentum flavum

SymbolForward primer 5′-3′Reverse primer 5′-3′
actinGACAGGATGCAGAAGGAGATTACTTGATCCACATCTGCTGGAAGGT
P16ATGGAGCCTTCGGCTGACTGTAACTATTCGGTGCGTTGGG
S100TGGCCCTCATCGACGTTTTCATGTTCAAAGAACTCGTGGCA