Skip to main content

Table 2 Primer details for semiquantitative RT-PCR

From: The human arthritic hip joint is a source of mesenchymal stromal cells (MSCs) with extensive multipotent differentiation potential

GenePrimer sequences (5′-3′)Annealing temperature (°c)Product size (base pairs)CyclesMgCl2
Housekeeping gene for internal control 
 EEF1αSense: AGGTGATTATCCTGAACCATCC Antisense: AAAGGTGGATAGTCTGAGAAGC54.0234211 x
Adipogenic marker genes 
 LPLSense:
GAGATTTCTCTGTATGGCACC
Antisense:
CTGCAAATGAGACACTTTCTC
51.0239301x
 PPARγSense:
GCTGTTATGGGTGAAACTCTG
Antisense:
ATAAGGTGGAGATGCAGGCTC
61.0297351x
Osteogenic marker genes 
 Col ISense:
GGACACAATGGATTGCAAGG
Antisense:
TAACCACTGCTCCACTCTGG
55.0461222x
 Col XSense:
CCCTTTTTGCTGCTAGTATCC
Antisense:
CTGTTGTCCAGGTTTTCCTGGCAC
54.0468401x
 ALPSense:
TGGAGCTTCAGAAGCTCAACACCA
Antisense:
ATCTCGTTGTCTGAGTACCAGTCC
51.0454331x
 OCSense:
ATGAGAGCCCTCACACTCCTC
Antisense:
GCCGTAGAAGCGCCGATAGGC
62.0293352x
Chondrogenic marker genes 
 AGGSense:
GCCTTGAGCAGTTCACCTTCAntisense:
CTCTTCTACGGGGACAGCAG
54.0400351x
 Col IISense:
TTTCCCAGGTCAAGATGGTC
Antisense:
CTTCAGCACCTGTCCACCA
51.0155311x
 Sox-9Sense:
ATCTGAAGAAGGAGAGCGAG
Antisense:
TCAGAAGTCTCCAGAGCTTG
60.0263311x
  1. EEF 1α Elongation factor 1α, LPL Lipoproteinlipase, PPARγ Peroxisome proliferator-activated receptor γ, Col I Collagen type I, Col X Collagen type X, ALP Alkaline phosphatase, OC Osteocalcine, AGG Aggrecane, Col II Collagen type II, Sox-9 Sex-determining region Y-box 9