Skip to main content

Table 1 Sequences of primers used in qRT-PCR

From: MicroRNA-532-5p is implicated in the regulation of osteoporosis by forkhead box O1 and osteoblast differentiation

Gene Forward primer (5′-3′) Reversed primer (5′-3′)
miR-532-5p CTTCCATGCCTTGAGTGTA GTGTGGGAGGGTAATTAAGATG
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
FOXO1 CCAGCCCAAACTACCAAAAATA GAGGAGAGTCAGAAGTCAGCAAC
OC CTGACAAAGCCTTCATGTCCAA GGTAGCGCCGGAGTCTGTT
ALP GACAAGAAGCCCTTCACTGC AGACTGCGCCTGGTAGTTGT
COL1A1 GGGTCTAGACATGTTCAGCTTTGTG ACCCTTAGGCCATTGTGTATGC
GAPDH ACAACTTTGGTATCGTGGAAGG GCCATCACGCCACAGTTTC