Skip to main content

Table 1 Primer sequences for RT-qPCR

From: Proper mechanical stress promotes femoral head recovery from steroid-induced osteonecrosis in rats through the OPG/RANK/RANKL system

Primer Sequence (5′-3′)
OPG F: TTTGCCTGGGACCAAAGTGAATGCAGAGAG
R: AGAAATGATAGGGAATCAGGTTCAATCAGT
RANK F: TGGACAACCCAGGAAACCTTTCCTCCAAAA
R: GCCAGCCGAGACTACGGCAAGTACCTGCGC
RANKL F: GGCCA GGTGG TCTGC AGCATCGCTCTGTTC
R: TTTATAGAATCCTGAGACTCCATGAAAACG
GAPDH F: CGGACCAATACGACCAA
R: AGCCACATCGCTCAGACACC
  1. RT-qPCR Reverse transcription quantitative polymerase chain reaction, OPG Osteoprotegerin, RANK Receptor activator of nuclear factor kappa B, RANKL RANK ligand, GAPDH Glyceraldehyde-3-phosphate dehydrogenase, F Forward, R Reverse