Skip to main content

Table 1 Characteristics of polymorphisms by measurement methods

From: CHD7 gene polymorphisms in female patients with idiopathic scoliosis

SNPLocationNucleotide positionAnalysis methodEnzymeNucleotide variantsPrimer’s sequence 5′➔3′Annealing temperature
rs78874766Intronic60,777,684Sequencingn/aA/GCATCGGGTCTCCTTTGGTTA58 °C
rs473882460,777,762A/GATCAATTCCCACTGCCTGAC
rs7479761360,777,857A/G
rs13248429Exon 260,742,360RFLPNcoIA/TCAGCAGATGGGCAGCTATATG
ATTAGTCCTTGACCACTGTTTGATG
rs1017861Intronic60,706,154EcoRIA/GGTCCTGAGCTATGCAGTTCCA61 °C
ACCCCTTGTTCTTTCATCACCT
rs4738813Intronic60,683,112DpnIIC/TGCAAGCCTTCCATGGTTAAA65 °C
AGCTATGGACCTCTGCCATC
  1. Abbreviations: SNP single nucleotide polymorphism, RFLP restriction fragment length polymorphism, n/a not applicable