Skip to main content

Table 2 Primer sequences used for qRT-PCR

From: Substantive molecular and histological changes within the meniscus with tears

U6 F (5′CTCGCTTCGGCAGCACA)
R (5′AACGCTTCACGAATTTGCGT)
hCOL10A1 F (5′CAAGGCACCATCTCCAGGAA)
R (5′AAAGGGTATTTGTGGCAGCATATT)
hMMP13 F (5′GCCAAATTATGGAGGAGATGC)
R (5′GCCGGTGTAGGTGTAGATAGGAA)
hCEBPβ F (5′TGGAGACGCAGCACAAGGTCC)
R (5′GCTTGAACAAGTTCCGCAGGGTG)
hADAMTS5 F (5′CAAGTGCGGAGTATGTGGAGG)
R (5′GGTCTTTGGCTTTGAACTGTCG)
hACAN F (5′CCGCTACGACGCCATCTGCTA)
R (5′ATCACGCTGCCTCGGGCTTCAC)
hsa-miR-193b-3p F (5′TGGCCCTCAAAGTCCCGCTAA)
hsa-miR-455-3p F (5′GCAGTCCATGGGCATATACAC)
hsa-miR-92a-3p F (5′TATTGCACTTGTCCCGGCCTGT)
hsa-miR-381-3p F (5′GGGCAAGCTCTCTGTAAAAAA)