Skip to main content

Table 2 Primers sequences for cell free nuclear DNA and mitochondrial DNA

From: Changes in circulating cell-free nuclear DNA and mitochondrial DNA of patients with adolescent idiopathic scoliosis

GENE Primer sequence (5′–3′) Length (bp)
GAPDH F: GGAGAAGCTGAGTCATGGGT 219
  R: AAGACGGAATGGGGAGAAGG  
ACTB F: CTGGAACGGTGAAGGTGACA 65
  R: CGGCCACATTGTGAACTTTG  
MT-ND1 F: CCCTAAAACCCGCCACATCT 214
  R: CCGATCAGGGCGTAGTTTGA  
  1. Abbreviation: F Forward, R Reverse