Skip to main content

Table 1 Sequences of the primers used in this study

From: Elevated leptin levels induce inflammation through IL-6 in skeletal muscle of aged female rats

Gene Direction Primer Sequence (5′–3′) Product Size (bp)
Il6 F CCAGTTGCCTTCTTGGGACT 224
R TCTGACAGTGCATCATCGCT
Il1b F CCTCGTCCTAAGTCACTCGC 156
R GCAGAGTCTTTTTGACCCTCCT
Tnfa F CTCTTCTCATTCCCGCTCGT 104
R GGGAGCCCATTTGGGAACTT
MuRF1 F TGCAAGGAACACGAAGACGA 170
R ACAAGGAGCAAGTAGGCACC
Atrogin1 F GGTCTCACGATCACCGACCT 136
R TCCACAGTAGCCGGTCTTCA
Gapdh F TGC CAC TCA GAA GAC TGT GG 129
R TTCAGCTCTGGGATGACCTT