Skip to main content

Table 1 Gene primer information

From: Articular cartilage gene expression patterns in the tissue surrounding the impact site following applications of shear and axial loads

Gene Name Sequence (5′ - > 3′) Annealing Temp Amplicon length NCBI Number
Cartilage Matrix
 Collagen, Type I, Alpha 1 (Col1a1) F: CAACCGCTTCACCTACAGC    
R: TTTTGTATTCGATCACTGTCTTGCC 60 101 AK236626
 Collagen, Type II, Alpha 1 (Col2a1) F: GAGAGGTCTTCCTGGCAAAG    
R: AAGTCCCTGGAAGCCAGAT 60 118 AF201724.1
 Aggrecan (Acan) F: TGCAGGTGACCATGGCC    
R: CGGTAATGGAACACAACCCCT 60 79 AF201722b
 SRY (sex determining gene region Y) box-9 (Sox9) F: CAGGGCTCTGTGCTCTACTCC    
R: GGGTTACGGTCTTTCTTCGGT 60 230 NM_213843.1
 Osteopontin (Opn) F: CCGCAGCCAGGAGCAGTC    
R: GTTGATCTCAGAAGACGCACTCTC 55 214 NM_214023.1
 Cartilage oligometric matrix protein (Comp) F: GGCTGGAAGGACAAGACATC    
R: CCTCATAGAACCGCACTCTG 55 82 XM_003123529.1
Degradative Enzymes & Inhibitors
 Matrix metalloprotease-1 (Mmp1) F: TGATGGACCTGGAGGAAACC    
R: GAGCAGCCACACGATACAAG 59 131 NM_001166229
 Matrix metalloprotease-3 (Mmp3) F: GATGTTGGTTACTTCAGCAC    
R: ATCATTATGTCAGCCTCTCC 50 197 NM_001166308.1
 Matrix metalloprotease-13 (Mmp13) F: CCAAAGGCTACAACTTGTTTCTTG    
R: TGGGTCCTTGGAGTGGTCAA 60 77 AF069643
 TIMP Metallopeptidase Inhibitor-1 (Timp1) F: CCTCGTACCAGCGTTATG    
R: CGTTCCACAGTTGTCCAG 59 177 NM_213857.1
 TIMP Metallopeptidase Inhibitor-2 (Timp2) F: ATATACGAGAACACCAGACC    
R: GGAATGATTACAACGGATGC 59 152 AK237154.1
 ADAM Metallopeptidase with Thrombospondin Type 1 Motif 5 (Adamts5) F: CGCTGCCACCACACTCAA    
R: CGTAGTGCTCCTCATGGTCATCT 60 80 NM_007038.3
Inflammatory Response
 Indian Hedgehog (Ihh) F: CAGCGGGCGCTATGAAGGCA    
R: GGTCCTTGCAGCGCTGGGTC 60 140 XM_001925486.1
 Transforming growth factor β (Tgfb) F: GGAGTGGCTGTCCTTTGATGT    
R: AGTGTGTTATCTTTGCTGTCA 60 117 NM_214015.1
 nitric oxide synthase 2, inducible (Inos) F: TGAATTTGTCAACCTGTATTAC    
R: CTTTGTTACCGCTTCCAC 53 82 NM_001143690.1
 Chitinase-3-like protein 1 (Chi3l1) F: TGACGCTCTATGACACAC    
R: GGCTAGGTCCAGTCCATC 62 194 NM_001001540
Cell Proliferation and Apoptosis
 Caspase-8 (Casp8) F: TGGGCAAACAGATGCCACAACCT    
R: CCCCTTCAATCTAGCCCACCCCC 60 153 NM_001031779.2
 Fas (TNF receptor superfamily, member 6) (Fas) F: TAGAGTTTGTGATGGAGAA    
R: ATTGAGAAGTGTGACAGA 53 107 NM_213839.1
  1. Full names with abbreviations, primer sequences, annealing temperatures, amplicon length, and NCBI numbers