Skip to main content

Table 1 Primer

From: The effect of autologous platelet rich plasma on tenocytes of the human rotator cuff

Target gene Accession number Product size [bp] Primer sequence [5′ – 3′]
GAPDH NM_002046 115 Forward: CCACTCCTCCACCTTTGACG
Reverse: CATGAGGTCCACCACCCTGT
Col-I NM_000088 197 Forward: TGACCTCAAGATGTGCCACT
Reverse: ACCAGACATGCCTCTTGTCC
Col-III NM_000090 199 Forward: GCTGGCATCAAAGGACATCG
Reverse: TGTTACCTCGAGGCCCTGGT
Osteocalcin NM_199173 209 Forward: CCCAGGCGCTACCTGTATCAA
Reverse: CTGGAGAGGAGCAGAACTGG