Skip to main content

Table 6 Information of human primers for Real-time PCR

From: The hsa-miR-181a-5p reduces oxidation resistance by controlling SECISBP2 in osteoarthritis

Gene Sequence (5′-3′) Product size (bp) Annealing temperature (°C)
SBP2 Forward: CCGCAGATTCAGGGATTACT 92 60
Reverse: CTTGGAAACGGACCAGTTCT
ACAN Forward: GGCATTTCAGCGGTTCCTTCTC 135 60
Reverse: AGCAGTTGTCTCCTCTTCTACGG
MMP13 Forward: AATATCTGAACTGGGTCTTCCAAAA 102 60
Reverse: CAGACCTGGTTTCCTGAGAACAG
COL2A1 Forward: TGGACGATCAGGCGAAACC 244 62
Reverse: GCTGCGGATGCTCTCAATCT
GPx1 Forward: AAGCTCATCACCTGGTCTCC 124 60
Reverse: CGATGTCAATGGTCTGGAAG
GPx4 Forward: GCTGTGGAAGTGGATGAAGA 105 60
Reverse: TGAGGAACTGTGGAGAGACG
SELS Forward: CACCTATGGCTGGTACATCG 130 60
Reverse: AACATCAGGTTCCACAGCAG
GAPDH Forward: CACCCACTCCTCCACCTTTG 110 64
Reverse: CCACCACCCTGTTGCTGTAG