Skip to main content

Table 3 Information of human primers for hSBP2-CDS

From: The hsa-miR-181a-5p reduces oxidation resistance by controlling SECISBP2 in osteoarthritis

Gene Sequence (5′-3′)
hSBP2-CDS-Forward CAGGTCGGATCCAGACCCGGGgccaccATGGCGTCGGAGGGG
hSBP2-CDS-Reverse TCTGTAGAATTCGGTCCCGGGTAAATTCAAATTCATCAT