Skip to main content

Table 1 Information of Mature miR-181a-5p

From: The hsa-miR-181a-5p reduces oxidation resistance by controlling SECISBP2 in osteoarthritis

ID Accession Mature sequence (5′-3′)
hsa-miR-181a-5p MIMAT0000256 AACAUUCAACGCUGUCGGUGAGU
mmu-miR-181a-5p MIMAT0000210