Skip to main content

Table 1 Primers used in RT-PCR

From: Triamcinolone Acetonide affects TGF-β signaling regulation of fibrosis in idiopathic carpal tunnel syndrome

Gene Reference Forward Reverse
TGF-β1 NM_000660 GTGGAAACCCACAACGAAAT CGGAGCTCTGATGTGTTGAA
COL1A2 NM_000089 TCCAAAGGAGAGAGCGGTAA CAGATCCAGCTTCCCCATTA
COL3A1 NM_000090 CCAGGAGCTAACGGTCTCAG CAGGGTTTCCATCTCTTCCA
VEGFA NM_003376 AGGCCAGCACATAGGAGAGA TTTCTTGCGCTTTCGTTTTT
TBP NM_003194 GGTTTGCTGCGGTAATCATGA CTCCTGTGCACACCATTTTCC
\