Skip to main content

Table 1 Primers used for RT-PCR analysis of musculoskeletal marker expression

From: Effects of mesenchymal stromal cells versus serum on tendon healing in a controlled experimental trial in an equine model

Gene Primer pair sequences GenBank accession number PCR product in bp
ACTB For: ATCCACGAAACTACCTTCAAC NM_001081838.1 174
Rev: CGCAATGATCTTGATCTTCATC
GAPDH For: TGGAGAAAGCTGCCAAATACG NM_001163856.1 309
Rev: GGCCTTTCTCCTTCTCTTGC
Collagen 1A2 For: CAACCGGAGATAGAGGACCA XM_001492939.1 243
Rev: CAGGTCCTTGGAAACCTTGA
Collagen 2A1 For: ATTGTAGGACCCAAAGGACC XM_001496152 199
Rev: CAGCAAAGTTTCCACCAAGG
Collagen 3A1 For: AGGGGACCTGGTTACTGCTT XM_001917620.2 216
Rev: TCTCTGGGTTGGGACAGTCT
Decorin For: ACCCACTGAAGAGCTCAGGA NM_001081925.2 239
Rev: GCCATTGTCAACAGCAGAGA
Tenascin-C For: CTAGAGTGTCTCACTATCAGG XM_001916622.2 163
Rev: CTAGAGTGTCTCACTATCAGG
Scleraxis For: TACCTGGGTTTTCTTCTGGTCACT NM_001105150.1 51
Rev: TATCAAAGACACAAGATGCCAGC
Osteopontin For: TGAAGACCAGTATCCTGATGC XM_001496152 158
Rev: GCTGACTTGTTTCCTGACTG