Skip to main content

Table 1 Primer sequences for murine genes

From: A comparison of the stem cell characteristics of murine tenocytes and tendon-derived stem cells

Gene Forward Primer Reverse Primer
GAPDH GAGAGGCCCTATCCCAACTC GTGGGTGCAGCGAACTTTAT
CD90 GGATGAGGGCGACTACTTTTGT TTGGAGCTCATGGGATTCG
CD73 TGGTTCACCGTTTACAAAGG CGCTCAGAATTGGAAATTTAAC
TNC AGGCGATCCCAGCCAGTCAGT ATGGACGGGGCACCTCCTGTC
SCX AAGTTGAGCAAAGACCGTGACA TGTGGACCCTCCTCCTTCTAAC
MKX AGTAAAGACAGTCAAGCTGCCACTG TCCTGGCCACTCTAGAAGCG
Sca-1 GTTTGCTGATTCTTCTTGTGGCCC ACTGCTGCCTCCTGAGTAACAC
NANOG AGGGTCTGCTACTGAGATGCTCTG CAACCACTGGTTTTTCTGCCACCG
TNMD AACTCCACCTCAGCAGTAGTCC TTTCTTGGATACCTCGGGCCAGAA
THBS4 TCCTCCGCTACCTGAAGAATGATGG TTCAATGGACTCTGGGTTCTGGGTG
CD45 AGTTAGTGAATGGAGACCAGGAA TCCATAAGTCTGCTTTCCTTCG
RUNX2 ATGCGTATTCCTGTAGATCCG TTGGGGAGGATTTGTGAAGAC
OC CTCTGTCTCTCTGACCTCACA CAGGTCCTAAA AGTGATACC
OSX GAAAGGAGGCACAAAGAAG CACCAAGGAGTAGGTGTGTT
OPN CATGAGATTGGCAGTGATTTGC TGCAGGCTGTAAAGCTTCTCCT
FABP4 GAAGCTTGTCTCCAGTCAAAA AGTCACGCCTTTCATAACACAT
PPARĪ³ CTCCGTGATGGAAGACCACTC AGACTCGGAACTCAATGGC
LEPTIN CTTCACCCCATTCTGAGTTTGT TTCTCCAGGTCATTGGCTATCT
SOX9 TGGCAGACCAGTACCCGCATCT TCTTTCTTGTGCTGCACGCGC
COL2A1 GGTTTGGAGAGACCATGAAC TGGGTTCGCAATGGATTGTG
AGG TTGCCAGGGGGAGTTGTATTC GACAGTTCTCACGCCAGGTTTG