Skip to main content

Table 2 Four pairs of primers were used to amplify and synthesize the human BMPR-IA gene for the following mutations (MT -349C > T, MT 4A > C) by PCR using pcDNA3.1/BMPR-IA wild type plasmid as the template

From: Genetic polymorphisms in bone morphogenetic protein receptor type IA gene predisposes individuals to ossification of the posterior longitudinal ligament of the cervical spine via the smad signaling pathway

SNPs Primer Forward Reverse Annealing Temperature (°C)
-349C > T Primer 1 CCGGAATTCACCATGGTGGCCGGGACC CCGACGCCGCCGCCGCGAACTT 60
  Primer 2 TCGCGGCGGCGGCGTCGG CCGCTCGAGCTAGCGACACCCACAACCCTCCA 60
4A > C Primer 1 CCGGAATTCACCATGGTGGCCGGGACC CTGGTGTCCAAAAGTCTGGTCACGGG 60
  Primer 2 CCCCGTGACCAGACTTTTGGACACC CCGCTCGAGCTAGCGACACCCACAACCCTCCA 60