Skip to main content

Table 1 Ten pairs of primers were used to amplify the complete exon sequences of human BMPR-IA gene by PCR using a standard protocol

From: Genetic polymorphisms in bone morphogenetic protein receptor type IA gene predisposes individuals to ossification of the posterior longitudinal ligament of the cervical spine via the smad signaling pathway

Primer Forward Reverse Annealing temperature (°C)
Primer1 GCGTTGGATGGGAGCGATAA GGAAGCTGCGCACAGTGTTG 58
Primer2 CTCACGTCGGTCCTGTCC CCCTGCTCCATGCCTCAC 61
Primer3 CGGAGGAGTTTATCACCTCAGCAGAGC TTCCATCATGGCCAAAAGTTACTAGCA 60
Primer4 AGAGATTGGAATCCGCCTGCCGGGCTT ACCCGCGAGTGGGAGACAAAAGAGG 55
Primer5 GGACTATTGAGATTGTTTAATATAC GAAAGAACAGAAGCAAGAAATAGTG 55
Primer6 GGACTATTGAGATTGTTTAATATAC GAAAGAACAGAAGCAAGAAATAGTG 55
Primer7 CCACAATGCATCTGGCCCCAAGGAG TGTGATTATTACACATGGCATGCCTGTATC 55
Primer8 ACATCAGATTACTGGGAGCC TATAGCAAAGCAGCTGGAG 52
Primer9 AAGCCTTAAGAAGATAAATGA ATTACCCTAATGAAGTTTTTG 62
Primer10 TGATTAGTGTCTCCAGTCAAGC TCTCAGGTAAAAGGCAAAGTC 50