Skip to main content

Table 1 List of primers used for real-time PCR

From: Hemoglobin stimulates the expression of ADAMTS-5 and ADAMTS-9 by synovial cells: a possible cause of articular cartilage damage after intra-articular hemorrhage

Target Sequence (5′ → 3′)
ADAMTS-5 sense CAAGCGTTTAATGTCTTCAATCCTTA
ADAMTS-5 antisense ACTGCTGGGTGGCATCGT
ADAMTS-9 sense GGACAAGCGAAGGACATCC
ADAMTS-9 antisense ATCCATCCATAATGGCTTCC