Skip to main content

Advertisement

Table 6 qRT-PCR primer sequences

From: Gene expression profiling in patients with polymyalgia rheumatica before and after symptom-abolishing glucocorticoid treatment

Gene Sense Antisense
ACTA1 GCCGTGTTCCCGTCCATCGT TTCAGGGTCAGGATACCTCTCTTGCT
BDNF GAGGGGAGCTGAGCGTGTGTG TTTTTGTCTGCCGCCGTTACCC
COL5A1 CGCCGACACCTCCAACTCCTC CTCAGTGAACTCCCCCTCCAA
DES CCATCCAGACCTACTCTGCCCTC TTGGTATGGACCTCAGAACCCCTTT
EIF4B CGTCAGCTGGATGAGCCAAAA GTCCTCGACCGTTCCCGTTCC
IL6 GAGGCACTGGCAGAAAACAACC CCTCAAACTCCAAAAGACCAGTGATG
MARK4 AGATCCCAGAGCGGCGGAAG GGGTCATCATGCTAGGAGGGAGGTT
MTFP1 AAGGCAAGAAGGCTGGAGAGGTG ACAGAGGCTAGAGCCTGCCATACAAA
NPM1 GGTTTCCCTTGGGGGCTTTG GCACTGGCCCTGAACCACACTT
PRSS23 CAGCGGGTCTGGGGTCTATG GCCAATAATTTTTCGCTCCCACTTCT
TUBD1 TGATTGTTGGGAAGGCATGGA CAACAACCTGCTCTAATGACGTGAAA
TFRC TCGGGAATGCTGAGAAAACAGACA TTTTGGAGATACGTAGGGAGAGAGGAA
TNFA TTCCCCAGGGACCTCTCTCTAATC GAGGGTTTGCTACAACATGGGCTAC
TUBA8 GCCCAAGGATGTGAATGTCGCT GGTCGGGGGCTGGTAGTTGATG
RPLP0 GGAAACTCTGCATTCTCGCTTCCT CCAGGACTCGTTTGTACCCGTTG
  1. qRT-PCR quantitative real-time PCR
  2. The primer set sequence for BDNF provided in Table 6 recognizes all BDNF isoforms; using this primer set, the results presented in Table 5 were obtained. The BDNF mRNA levels were also assessed with qRT-PCR using a BDNF primer set that specifically recognizes the BDNF isoform that is recognized by the probe on the used microarray; the results (fold difference + 1.53, p < 0.1; fold change −2.4, p < 0.01) from this additional assessment were very similar to the results presented in Table 5