Skip to main content

Table 1 rtPCR primer sets for gene expression measurements

From: EGR1 controls divergent cellular responses of distinctive nucleus pulposus cell types

Symbol Forward primer Reverse primer
ADAMTS4 GGTCATGTCTTCAACATGCTCC AGGATCCACATGAGCCATCAC
COL1A1 TGGAGAGTACTGGATTGACCCC TGCAGAAGACTTTGATGGCATC
COL2A1 TGGGTGTTCTATTTATTTATTGTCTTCCT GCGTTGGACTCACACCAGTTAGT
COX2 ACCAACATGATGTTTGCATTCTTT GGTCCCCGCTTAAGATCTGTCT
EGR1 TGACCGCAGAGTCTTTTCCT TGGGTTGGTCATGCTCACTA
KRT19 GCAGTCACAGCTGAGCATGAA TCCGTTTCTGCCAGTGTGTCT
MMP3 TGATGAACAATGGACAAAGGATACA TTTCATGAGCAGCAACGAGAA
SOX9 AGTACCCGCACCTGCACAAC CGCTTCTCGCTCTCGTTCAG
T CCACCTGCAAATCCTCATCCT TTGGAGAATTGTTCCGATGAG
TNFα TCAATCGGCCCGACTATCTC CAGGGCAATGATCCCAAAGT
VCAN TCCCTCACTGTGGTCAAG GTGTGTACCTGCTGGTTG
βACT CCTGGCACCCAGCACAAT GCCGATCCACACGGAGTACT
CYCLO CCTGCTTCCACCGGATCAT CGTTGTGGCGCGTAAAGTC
EIF2B1 TGTCAGGTAAGAAAATGGCCAAA TGTAGCCGACAGCAGCATCT
MRPL19 CGCCGAAACCGGTCATC TCCCCTTCGAGGAATGAATTC