Skip to main content

Table 1 List of genes and oligonucleotide sequences of the primers used for real-time RT-PCR

From: Osteogenic potential of osteoblasts from neonatal rats born to mothers treated with caffeine throughout pregnancy

Gene Primers: 5′-3′ Access number
GAPDH Foward: CAACTCCCTCAAGATTGTCAGCAA NM 002046
Reverse: GGCATGGACTGTGGTCATGA
Type 1 collagen Foward: ACGTCCTGGTGAAGTTGGTC NM 000088
Reverse: CAGGGAAGCCTCTTTCTCCT
Osteocalcin Foward: CATCTATGGCACCACCGTTT NM 013414.1
Reverse: AGAGAGAGGGAACAGGGAGG
Bone sialoprotein Foward: TGTCCTTCTGAACGGGTTTC NM 012587.2
Reverse: CTTCCCCATACTCAACCGTG  
Osteopontin Foward: ATCTCACCATTCCGATGAATCT AB001382
Reverse: TCAGTCCATAAGCCAAGCTATCA
Alkaline Phosphatase Foward: CTAGTTCCTGGGAGATGGTA AC_000073.1
Reverse: GTGTTGTACGTCTTGGAGAGA
Runx-2 Forward: GCGTCAACACCATCATTCTG NM_004348
Reverse: CAGACCAGCAGCACTCCATC