Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 1 Primers using the characteristics of SP cells and differentiated cells

From: Isolation and characterization of side population stem cells in articular synovial tissue

  NCBI Gene ID Forward Reverse Amplicon
β-actin 280979 AGGTCATCACCATCGGCAAT; ex 3* GAATGCCGCAGGATTCCAT; ex 4 87 bp
CD34 281051 TGCTATTTCCTGATGAACCGC; ex 7 TCCACGTAATAAGGGTCTTCGC; ex 8 74 bp
Flk-1 407170 TTCCAAGTGGCTAAGGGCAT; ex 22 TTTAACCACGTTCTTTTCCGACA; ex 23 102 bp
c-Kit 280832 CAAGGAAGGTTTCCGAATGC; ex 19 CCCAGCAGGTCTTCATGATGT; ex 20 74 bp
Abcb-1 (Mdr-1) 281585 GCAAAGCAGGCGAGATCC; ex 17 TCAATGCTCCCGTGGTGTT; ex 18 111 bp
Abcg-2 (Bcrp-1) 536203 CCTTGGTTGTCATGGCTTCA; ex 14 AGTCCTGGGCAGAAGTTTTGTC; ex 15 98 bp
Pcgf-4 (Bmi-1) 510666 GGCTGGAACCGCCTAAAAC; ex 1 TCTGCTTGATAAAAGATCGGCTC; ex 1–2 91 bp
COL1A1 282187 ATGGCGAAGCTGGAAAG; ex 9–10 CCACTGAAACCTCTGTGT; ex 11–12 121 bp
COL2A1 282189 TGGTATCGCCGGACCCAAG** CTCGTCCACCGTCCTTCCC** 82 bp
Aggrecan 280985 CACCTGTAAAAAGGGCACAGTG; ex 15 GCATTGATCTCGTATCGGTCC; ex 16 95 bp
CD-RAP 280857 TGACCGGAAGATGTGTGCC; ex 2 CACGTAGTCCTGAAGGGCCA; ex 3 73 bp
MyoD-1st 281938 CAAACGCAAGACGACTAACG; ex 1 TGTAGTAAGTGCGGTCGTAG; ex 2 392 bp
MyoD-2nd 281938 AACGCCATCCGCTATATCG; ex 1 TGTAGTCCATCATGCCGTCG; ex 2 187 bp
Myf-5 281335 ACATTGAGAGTCTGCAGGAG; ex 1 TTGCTCTGAGTTGGTGATC; ex 3 269 bp
Osteocalcin 281646 AGATGCAAAGCCTGGTGATG; ex 2 ATGTGGTCAGCTAGCTCGTC; ex 4 192 bp
  1. *Number of exons (ex) to which the primer binds.
  2. **Detailed information has not been reported.