Skip to main content

Advertisement

Table 1 Primer and probe nucleotide sequences of the tested genes

From: Intrinsic differentiation potential of adolescent human tendon tissue: an in-vitro cell differentiation study

Gene Accession no. Primer Probe
GAPDH NM_002046.2 F: ATGGGGAAGGTGAAGGTCG
R: TAAAAGCAGCCCTGGTGACC
CGCCCAATACGACCAAATCCGTTGAC
RUNX2 NM_001024630.1
NM_00101505.1
NM_0043468.3
F: GCCTTCAAGGTGGTAGCCC
R: CGTTACCCGCCATGACAGTA
CCACAGTCCCATCTGGTACCTCTCCG
BGLAP NM_199173.2 F: GAAGCCCAGCGGTGCA
R: CACTACCTCGCTGCCCTCC
TGGACACAAAGGCTGCACCTTTGCT
PPARG* NM_138712.2
NM_015869.3
NM_005037.4
NM_138711.2
F: AGGGCGATCTTGACAGGAAA
R: TCTCCCATCATTAAGGAATTCATG
 
SOX9 NM_000346.2 F: CAACGCCGAGCTCAGCA
R: TCCACGAAGGGCCGC
TGGGCAAGCTCTGGAGACTTCTGAACG
AGC1 NM_001135.1
NM_013227.1
F:TCGAGGACAGCGAGGCC
R:TCGAGGGTGTAGCGTGTAGAGA
ATGGAACACGATGCCTTTCACCACGA
COL2A1 NM_033150 F: GGCAATAGCAGGTTCACGTACA
R: CGATAACAGTCTTGCCCCACTT
CCGGTATGTTTCGTGCAGCCATCCT
COL10A1 NM_000493.2 F: CAAGGCACCATCTCCAGGAA
R: AAAGGGTATTTGTGGCAGCATATT
TCCAGCACGCAGAATCCATCTGA
  1. F: forward; R: reverse; * SYBR®Green assay. Commercially available, so-called assays-on-demand (Applied Biosystems, Foster City, CA, U.S.A.) were used to detect osterix (SP7; Hs_00541729_m1) and fatty acid binding protein 4 (FABP4; Hs_00609791)-specific mRNA.