Skip to main content

Table 1 Primer sequences and sizes of amplicons generated by Real-time RT-PCR

From: Expression of genes for bone morphogenetic proteins BMP-2, BMP-4 and BMP-6 in various parts of the human skeleton

mRNA Forward primer (5'-3') Reverse primer (5'-3') Annealing [°C] Amplicon [bp] Accession number Citation
BMP-2 ATGGATTCGTGGTGGAAGTG GTGGAGTTCAGATGATCAGC 58 349 NM_001200.2 [41]
BMP-4 AGCATGTCAGGATTAGCCGA TGGAGATGGCACTCAGTTCA 58 399 NM_130851.1 [41]
BMP-6 CAGCCTGCAGGAAGCATGAG CAAAGTAAAGAACCGAGATG 53 246 NM_001718.2 [42]
β-actin GGGTCAGAAGGATTCCTATG GGTCTCAAACATGATCTGGG 58 237 NM_001101.2 [43]